Our DNA is made up of lots of individual building blocks represented by the letters A,C,T and G. The DMPK gene contains lots of Cs,Ts and Gs repeated over and over like this:
CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG…
The CTG ‘triplet’ in the DMPK gene is usually repeated between five and 34 times in a healthy person. However, in someone with myotonic dystrophy type 1, the CTG triplet is unstable and is repeated more than this.
The number of CTG repeats in the DMPK gene generally correlates with the severity of myotonic dystrophy type 1 and the age of onset. For example, individuals with 50 to 100 repeats are usually mildly-affected and symptoms may not arise until adulthood. In contrast, individuals with thousands of repeats are likely to have the severe, congenital (present from birth) form of the condition. The number of CTG repeats, and hence the severity of the condition, usually increases from generation to generation.
Recent scientific advances have shown that too many CTG repeats leads to abnormal RNA production in the cells of people with myotonic dystrophy type 1. When a gene is expressed (or active), RNA copies of the gene are produced in the cell nucleus. This RNA acts as a messenger that travels out of the nucleus and then instructs the cell’s machinery to make proteins.
In myotonic dystrophy type 1, this RNA production process is disrupted. Too many CTG repeats in the DMPK gene cause the resulting RNA to have an unusual shape (see figure below). It becomes trapped in clumps in the nucleus and affects the function of important proteins that regulate other genes. It is the disruption of these other genes that is thought to cause the body-wide symptoms of myotonic dystrophy type 1.
How is myotonic type 1 (DM1) dystrophy inherited?
The condition follows a ‘dominant’ inheritance pattern, which means that children of a person with the condition have a 50 percent chance of inheriting it. Men and women are equally likely to be affected and to pass on the condition, but children of women with the condition are likely to be more severely affected. In general, though not always, the condition tends to be more severe with each generation OR in each younger generation. Please also see our factsheet on congenital myotonic dystrophy for more information on the most severe form of myotonic dystrophy.
Very few cases of myotonic dystrophy occur ‘out of the blue’ with no evidence of family history. Almost always, one parent is affected, often very mildly. Some parents (or grandparents) may carry a very slight genetic change that will never cause any symptoms and may not be diagnosed. Careful study of the whole family often shows more members with the condition than would appear likely at first.
What causes Myotonic dystrophy type 2 (DM2) or PROMM (proximal myotonic myopathy)?
This condition was initially called proximal myotonic myopathy (PROMM) because affected individuals had clinical signs of myotonic dystrophy but did not have the increased number of CTG repeats in the DMPK gene. It was later discovered that these individuals instead had a similar genetic fault in a different gene. This led to the condition being renamed as myotonic dystrophy type 2 (DM2).
People with myotonic dystrophy type 2 have a genetic fault (mutation) in the CNBP gene (also called the ZNF9 gene) on chromosome 3. Although this gene is quite different from the DMPK gene that is mutated in myotonic dystrophy type 1, it contains a very similar, repeated section of DNA made up of lots of C’s, T’s and G’s:
CCTGCCTGCCTGCCTGCCTGCCTGCCTGCCTGCCTG…
The number of CCTG repeats in the CNBP gene is increased in people with myotonic dystrophy type 2. This is thought to disrupt RNA production in the cell, in a similar way to myotonic dystrophy type 1 (see figure above). Clumps of CNBP RNA build up in the cell nucleus and interrupt the activities of important proteins and genes. Exactly how this leads to symptoms is not well understood, but researchers are looking into this.
In contrast with type 1, the number of CCTG repeats does not relate to the age of onset or severity of myotonic dystrophy type 2. In addition, type 2 does not tend to get worse with each generation.
However both types are dominantly inherited. This means that children of an affected person have a 50 percent chance of inheriting it.
Clinicians and scientists are still learning about myotonic dystrophy type 2, but it is probably uncommon and accounts for only a small proportion of people in the UK thought to have a myotonic dystrophy